pE-FLP

pE-FLP
BBF10K_000016
source
The flippase gene was amplified from pCP20 (e.g. available from the Coli Genetic Stock Center)

Can be used to remove the integration module (including the antibiotic resistance cassette) from pOSIP integrants.

attr.
Drew Endy, Keith Shearwin

Usage

growth

shipping strain
E811 (P2 lysogen)
growth conditions
For propagation, please grow this plasmid in the original strain (E811) In that strain, the strong promoter pE will be repressed, thus avoiding possible toxicity and accumulation of unwanted mutations in the plasmid. Use 50ug/ml ampicillin (100ug/ml may inhibit growth)
antibiotic
Ampicillin, low (50ug/mL)

expression

strain
N/A
promoter
N/A
inducer
N/A

cloning

method
N/A
enzyme
N/A
overhangs
3' - No ValueNo Value - 5'

sequencing

forward primer
GGAATAAGGGCGACACGGAAATGTTGAATA
reverse primer
CCGTTACATATCAAAGGGAAAACTGTCC

Construct

plasmid name
pE-FLP
plasmid size
4389
insert size
N/A
origin
No Value
copy number
Low Copy

Safety

BSL
BSL1

other information

No Value

References

primary references

NCBI
No Value
UniProt
Available Elsewhere

protocols and instructions

No Value

citations

One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148

intellectual property

We are unaware of third-party property rights claims on uses of this item as of we.