pOSIP-CH (CamR, HK022)

pOSIP-CH (CamR, HK022)
BBF10K_000031
source
No Value

No Value

attr.
Drew Endy, Keith Shearwin

Usage

growth

shipping strain
DB3.1
growth conditions
Contains ccdB, so must be grown in a strain resistant to this product (e.g. DB3.1). Growth a 30C to repress expression of the integrase.
antibiotic
Chloramphenicol

expression

strain
N/A
promoter
N/A
inducer
N/A

cloning

method
Restriction Ligation
enzyme
Multiple Cloning Site
overhangs
3' - No ValueNo Value - 5'

sequencing

forward primer
TAAACTGCCAGGAATTGGGGATC
reverse primer
GAAACGCAAAAAGGCCATCCGTC

Construct

plasmid name
pOSIP-CH (CamR, HK022)
plasmid size
6224
insert size
N/A
origin
pUC
copy number
High Copy

Safety

BSL
BSL1

other information

No Value

References

primary references

NCBI
No Value
UniProt
Available Elsewhere

protocols and instructions

No Value

citations

One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148

intellectual property

We are unaware of third-party property rights claims on uses of this item as of we.