pOSIP-KO (KanR, 186)

pOSIP-KO (KanR, 186)
BBF10K_000492
source
No Value

Please note that there is a E59G mutation in Integrase 186. The mutation does not affect device function.

attr.
Drew Endy, Keith Shearwin

Usage

growth

shipping strain
DB3.1
growth conditions
Contains ccdB, so must be grown in a strain resistant to this product (e.g. DB3.1). Growth a 30C to repress expression of the integrase.
antibiotic
Kanamycin

expression

strain
N/A
promoter
N/A
inducer
N/A

cloning

method
Restriction Ligation
enzyme
Multiple Cloning Site
overhangs
3' - No ValueNo Value - 5'

sequencing

forward primer
TAAACTGCCAGGAATTGGGGATC
reverse primer
GAAACGCAAAAAGGCCATCCGTC

Construct

plasmid name
pOSIP-KO (KanR, 186)
plasmid size
6298
insert size
N/A
origin
pUC
copy number
High Copy

Safety

BSL
BSL1

other information

No Value

References

primary references

NCBI
No Value
UniProt
Available Elsewhere

protocols and instructions

No Value

citations

One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148

intellectual property

We are unaware of third-party property rights claims on uses of this item as of we.