CD19CAR-CD28z

anti-CD19 chimeric antigen receptor, intracellular CD28z
BBF10K_000527
source
Human

activating receptor on NK cells to bind to CD19

attr.
James N. Kochenderfer, Wyndham H. Wilson, John E. Janik, Mark E. Dudley, Maryalice Stetler-Stevenson, Steven A. Feldman, Irina Maric, Mark Raffeld, Debbie-Ann N. Nathan, Brock J. Lanier, Richard A. Morgan, and Steven A. Rosenberg

Usage

growth

shipping strain
DH5alpha
growth conditions
37 C, shaking 300 rpm
antibiotic
Kanamycin

expression

strain
Human
promoter
SFFV
inducer
N/A

cloning

method
Gibson assembly into viral backbone
enzyme
BamHI
overhangs
3' - CAGACTGAGTCGCCCGGGGGgatccgccacc … ggatccGCCACCAACTTCAGCCTGCT - 5'

sequencing

forward primer
CAGACTGAGTCGCCCGGGGGgatccgccacc
reverse primer
gcaggctgaagttggtggcggatcc

Construct

plasmid name
pOpen-CD19CAR-CD28z
plasmid size
6570
insert size
2182
origin
oriS
copy number
medium

Safety

BSL
2

other information

No Value

References

primary references

NCBI
UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

intellectual property

We are unaware of third-party property rights claims on uses of this item as of .