CD96

TACTILE T cell activation, increased late expression
BBF10K_000533
source
Human

may induce exhaustion/activation of NK cells

attr.
Nina Horowitz

Usage

growth

shipping strain
DH5alpha
growth conditions
37 C, shaking 300 rpm
antibiotic
Kanamycin

expression

strain
Human
promoter
SFFV
inducer
N/A

cloning

method
Gibson assembly into viral backbone
enzyme
BamHI
overhangs
3' - CAGACTGAGTCGCCCGGGGGgatccgccacc … ggatccGCCACCAACTTCAGCCTGCT - 5'

sequencing

forward primer
CAGACTGAGTCGCCCGGGGGgatccgccacc
reverse primer
gcaggctgaagttggtggcggatcc

Construct

plasmid name
pOpen-CD96
plasmid size
6300
insert size
1912
origin
oriS
copy number
medium

Safety

BSL
2

other information

No Value

References

primary references

UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

citations

N/A

intellectual property

We are unaware of third-party property rights claims on uses of this item as of .