CLEC12A

C-lectin type domain family 12 member A
BBF10K_000534
source
Human

activating receptor on NK cells

attr.
Nina Horowitz

Usage

growth

shipping strain
DH5alpha
growth conditions
37 C, shaking 300 rpm
antibiotic
Kanamycin

expression

strain
Human
promoter
SFFV
inducer
N/A

cloning

method
Gibson assembly into viral backbone
enzyme
BamHI
overhangs
3' - CAGACTGAGTCGCCCGGGGGgatccgccacc … ggatccGCCACCAACTTCAGCCTGCT - 5'

sequencing

forward primer
CAGACTGAGTCGCCCGGGGGgatccgccacc
reverse primer
gcaggctgaagttggtggcggatcc

Construct

plasmid name
pOpen-CLEC12A
plasmid size
5340
insert size
952
origin
oriS
copy number
medium

Safety

BSL
2

other information

No Value

References

primary references

UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

citations

N/A

intellectual property

We are unaware of third-party property rights claims on uses of this item as of .