ID2

inhibitor of DNA binding 2
BBF10K_000539
source
Human

transcription factor that may differentiate NK cells

attr.
Nina Horowitz

Usage

growth

shipping strain
DH5alpha
growth conditions
37 C, shaking 300 rpm
antibiotic
Kanamycin

expression

strain
Human
promoter
SFFV
inducer
N/A

cloning

method
Gibson assembly into viral backbone
enzyme
BamHI
overhangs
3' - CAGACTGAGTCGCCCGGGGGgatccgccacc … ggatccGCCACCAACTTCAGCCTGCT - 5'

sequencing

forward primer
CAGACTGAGTCGCCCGGGGGgatccgccacc
reverse primer
gcaggctgaagttggtggcggatcc

Construct

plasmid name
pOpen-ID2
plasmid size
4947
insert size
559
origin
oriS
copy number
medium

Safety

BSL
2

other information

No Value

References

primary references

UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

citations

N/A

intellectual property

We are unaware of third-party property rights claims on uses of this item as of .