pOMRP4β

sdhB_hph_Gluc
BBF10K_000571
source
G. lucidum; E. coli

Agrobacterium tumefaciens T-DNA conferring resistance to carboxin and hygromycin B to G. lucidum.

attr.
Rolando Perez

Usage

growth

shipping strain
DH5alpha
growth conditions
Grow at 37 C with shaking at 300 rpm to recover from E. coli.
antibiotic
Kanamycin

expression

strain
Ganoderma lucidum
promoter
GPD
inducer
N/A

cloning

method
Gibson Assemly
enzyme
N/A
overhangs
3' - N/A … N/A - 5'

sequencing

forward primer
gcctgtatcgagtggtgattttgtg
reverse primer
AATCGCGAGCTCACTAATCACCC

Construct

plasmid name
pOMRP4β
plasmid size
12874
insert size
3171; 1026
origin
pBR322 (E. coli), pVS1-REP (Agrobacterium)
copy number
No Value

Safety

BSL
1

other information

No Value

References

primary references

NCBI
No Value
UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

citations

No Value

intellectual property

We are unaware of third-party property rights claims on uses of this item as of 1.