pOMRP2

fuGFP_Gluc
BBF10K_000573
source
No Value

For fuGFP expression in G. lucidum.

attr.
Rolando Perez

Usage

growth

shipping strain
DH5alpha
growth conditions
Grow at 37 C with shaking at 300 rpm to recover from E. coli.
antibiotic
Ampicillin

expression

strain
Ganoderma lucidum
promoter
GPD
inducer
N/A

cloning

method
Gibson Assembly
enzyme
N/A
overhangs
3' - N/A … N/A - 5'

sequencing

forward primer
gtaaaacgacggccagt
reverse primer
caggaaacagctatgaccatg

Construct

plasmid name
pOMRP2
plasmid size
4720
insert size
723
origin
pBR322
copy number
No Value

Safety

BSL
1

other information

No Value

References

primary references

NCBI
No Value
UniProt
Available Elsewhere
FALSE

protocols and instructions

No Value

citations

No Value

intellectual property

We are unaware of third-party property rights claims on uses of this item as of 1.